| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.069908 |
| Chromosome: | chromosome 15 |
| Location: | 1478605 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g641875 | SMM | (1 of 2) PTHR10108//PTHR10108:SF714 - METHYLTRANSFERASE // METHYLTRANSFERASE OMS1, MITOCHONDRIAL; Phosphatidyl-N-methylethanolamine N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCATACATAACGCCTCAGCAAGGCGAAAGGTTCGTTGCCTATGCATGT |
| Internal bar code: | GACCGTCTCCCGGTCAGTTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 132 |
| LEAP-Seq percent confirming: | 46.3415 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAACACGCACCAATCAACG |
| Suggested primer 2: | CCAGGCTTCGGATCAGGTTT |