| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.069914 |
| Chromosome: | chromosome 15 |
| Location: | 1652316 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre19.g750697 | OPR111,NCL37 | Nuclear Control of chloroplast Like 37; (1 of 1) 2.4.99.3 - Alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase / GalNAc alpha-2,6-sialyltransferase I | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGTCGTATCTTGGTTTTGGGGTAATGTCTAGCTCCAGACAAAAACGGC |
| Internal bar code: | ACCTTCGACCCAGTCTTCCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 684 |
| LEAP-Seq percent confirming: | 21.7391 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACGGCTTGTCATTTGC |
| Suggested primer 2: | AGGATTGCATTGGAAGGGGG |