| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.069963 |
| Chromosome: | chromosome 2 |
| Location: | 5645562 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g115600 | MSC7 | Predicted protein with mechanosensitive ion channel domain; (1 of 1) IPR002048//IPR006685//IPR010920//IPR020568 - EF-hand domain // Mechanosensitive ion channel MscS // LSM domain // Ribosomal protein S5 domain 2-type fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCCATGGGTACTCAGGGGCACTCACGATGGCAGGCCGTGCGCATGCAC |
| Internal bar code: | TCCAGGTCGCTAAAGTTATGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4975 |
| LEAP-Seq percent confirming: | 88.6792 |
| LEAP-Seq n confirming: | 94 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 106 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTTCGCAGTATCGCATCC |
| Suggested primer 2: | GGTTACACGCAACCAACACC |