| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.069966 |
| Chromosome: | chromosome 16 |
| Location: | 2445993 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g660100 | (1 of 19) IPR008984 - SMAD/FHA domain | 3'UTR | |
| Cre16.g801913 | (1 of 1) PTHR11700:SF11 - 40S RIBOSOMAL PROTEIN S20 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCACACGTCCGCAATGGTCACCTCCACCTCCACACCGGGCTCGATGCT |
| Internal bar code: | GTATAAGTGACCTTTGCTTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 336 |
| LEAP-Seq percent confirming: | 91.3043 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACCTTCGACAAGCTGGAG |
| Suggested primer 2: | ATGGCCAGGAGTGTTGAAGG |