Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.069973 |
Chromosome: | chromosome 7 |
Location: | 3706021 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g337800 | MRPS17,uS17m | (1 of 3) PTHR10744 - 40S RIBOSOMAL PROTEIN S11 FAMILY MEMBER; Mitochondrial ribosomal protein S17 | 5'UTR |
Cre07.g337850 | (1 of 10) IPR005828//IPR020846 - Major facilitator, sugar transporter-like // Major facilitator superfamily domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTTCATATCGTTACTGCAACTGGATAGCGACACAGTAATGACGCAGT |
Internal bar code: | ACTCTCTAGATTCAGGGAATCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2821 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGATACTGCTCCGACGTC |
Suggested primer 2: | TGCAGCTCACATGACTCAGG |