| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.069973 |
| Chromosome: | chromosome 7 |
| Location: | 3706021 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g337800 | MRPS17,uS17m | (1 of 3) PTHR10744 - 40S RIBOSOMAL PROTEIN S11 FAMILY MEMBER; Mitochondrial ribosomal protein S17 | 5'UTR |
| Cre07.g337850 | (1 of 10) IPR005828//IPR020846 - Major facilitator, sugar transporter-like // Major facilitator superfamily domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTTCATATCGTTACTGCAACTGGATAGCGACACAGTAATGACGCAGT |
| Internal bar code: | ACTCTCTAGATTCAGGGAATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2821 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGATACTGCTCCGACGTC |
| Suggested primer 2: | TGCAGCTCACATGACTCAGG |