| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.070042 |
| Chromosome: | chromosome 14 |
| Location: | 2463566 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g623900 | (1 of 41) IPR000719//IPR011009 - Protein kinase domain // Protein kinase-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGGTGAACCTAATACCTCCTGTATCTTGCTCTGCCCGCTTATCCCCG |
| Internal bar code: | TAAGGTACGCTGAACTTACTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2445 |
| LEAP-Seq percent confirming: | 24.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCATTCGAAGTCCACGA |
| Suggested primer 2: | CTACCTGCACCTGTTCAGCA |