| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.070057 |
| Chromosome: | chromosome 6 |
| Location: | 7335279 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g299650 | CLPR6 | (1 of 3) PTHR10381//PTHR10381:SF24 - ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT // SUBFAMILY NOT NAMED; inactive subunit of chloroplast ClpP complex | 3'UTR |
| Cre06.g299700 | SOUL1 | (1 of 4) IPR006917//IPR011256 - SOUL haem-binding protein // Regulatory factor, effector binding domain; SOUL heme-binding protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTCCCAGGCTCGGGGCGGCTCGGATTGGATTGCTCAATTCGTGCGTG |
| Internal bar code: | TGTCTCGTAGCTTGCTTAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2090 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGCAAAGTAGCTGTATGC |
| Suggested primer 2: | ATTTGGAGTGCCAGGAGAGC |