| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.070073 |
| Chromosome: | chromosome 16 |
| Location: | 45055 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g695950 | MFL1 | Mitoferrin-like protein 1; (1 of 1) K15113 - solute carrier family 25 (mitochondrial iron transporter), member 28/37 (SLC25A28_37, MFRN) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGGCGCTGGAGGGCCATGTCTCGCCCGGGTAGCAGGTAGCAAGCTTGA |
| Internal bar code: | GCTTATATGTACCCAAGCGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5670 |
| LEAP-Seq percent confirming: | 97.4684 |
| LEAP-Seq n confirming: | 77 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCACCCCAGACGTTCTTCG |
| Suggested primer 2: | CCTTCTTCCGATCCTACCGC |