| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.070089 |
| Chromosome: | chromosome 6 |
| Location: | 403530 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g251600 | EIF5Bb,EIF5,EIF5B2 | (1 of 1) K03262 - translation initiation factor 5 (EIF5); Eukaryotic translation initiation factor 5 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATGTAACGAAGATGGACTGAAGCTGCATATGGGACGGAGAGCGCAAG |
| Internal bar code: | TGGAGTATAAATGTGATTAAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1384 |
| LEAP-Seq percent confirming: | 39.0244 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 75 |
| LEAP-Seq n unique pos: | 123 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGGGAGATGTGACGAAC |
| Suggested primer 2: | AGGACGAGGATGACGAGTGA |