| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.070099 |
| Chromosome: | chromosome 1 |
| Location: | 7884272 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g055440 | CSR8 | Carbohydrate sulfotransferase-related 8; (1 of 1) 2.8.2.30 - [Heparan sulfate]-glucosamine 3-sulfotransferase 3 / Heparan sulfate D-glucosaminyl 3-O-sulfotransferase 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGATTGGGGATGGGTCGTATCAGCGGGGGTGGGCTTGTGGCGGGGATA |
| Internal bar code: | GCATCTAATCTCAGTGTCCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1627 |
| LEAP-Seq percent confirming: | 1.63934 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 60 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCACCCATCCAGAAATGG |
| Suggested primer 2: | TCTTGAACTCCAGGAACCGC |