| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.070110 |
| Chromosome: | chromosome 14 |
| Location: | 2524355 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g624500 | RRP46 | Exosome complex exonuclease component; (1 of 1) K12590 - exosome complex component RRP46 (RRP46, EXOSC5) | 3'UTR |
| Cre14.g624550 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCACGCACCCCTGGCACGCACACGCACCGGTCAAACGGGTGCGGTTA |
| Internal bar code: | TCGTTAACCCAACCATCATGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3572 |
| LEAP-Seq percent confirming: | 76.2712 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTTAGGACATGCAGTGGC |
| Suggested primer 2: | GCACATACTCCCGCGATACA |