| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070134 |
| Chromosome: | chromosome 4 |
| Location: | 3354120 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g227350 | CCR4 | Putative NOT-complex component; (1 of 1) K12580 - CCR4-NOT transcription complex subunit 3 (CNOT3, NOT3) | gene_edge/outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGGGTTGGGGCTGGCCGGGTGGACGGACGGGAAGAAAGCAACATGCC |
| Internal bar code: | GTTAGTTCCCGTGCTTACAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1047 |
| LEAP-Seq percent confirming: | 24.6377 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGAACAGGGACGCACTGAG |
| Suggested primer 2: | CAGTAAGAGGGCCTGGGTTG |