| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070182 |
| Chromosome: | plastome |
| Location: | 90590 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802301 | ycf3,ChreCp037,2717008,pafI | (1 of 1) PTHR26312:SF81 - PHOTOSYSTEM I ASSEMBLY PROTEIN YCF3; photosystem I assembly factor I | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAATATAATTTGTTGGTGCTAAACGAATAGCTTCTTTCCAGTAATCTG |
| Internal bar code: | GGGTGTTATACACTATCTTTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1934 |
| LEAP-Seq percent confirming: | 17.6471 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAGCTTAAAAGGCACGTT |
| Suggested primer 2: | CAAGCCCATTACACGTGCAG |