| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070183 |
| Chromosome: | chromosome 2 |
| Location: | 7235948 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g390986 | TSD1 | (1 of 1) PTHR22594//PTHR22594:SF5 - ASPARTYL/LYSYL-TRNA SYNTHETASE // ASPARTATE--TRNA LIGASE, MITOCHONDRIAL; Putative organellar aspartyl-tRNA synthetase | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTCACACAGACTCACGGCTATGCCTTGGGGATGCTTTCACGCGCTTGA |
| Internal bar code: | TGTTAAGTCGTTTCTTCTCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6285 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 144 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 156 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAAACTTAGCACCGACCT |
| Suggested primer 2: | AGTCTTGGCCACGAGTTAGC |