| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070184 |
| Chromosome: | chromosome 9 |
| Location: | 5704077 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g410450 | ROC15,ROC74 | Rhythm Of Chloroplast 15; (1 of 4) IPR001005//IPR006447//IPR009057//IPR017930 - SANT/Myb domain // Myb domain, plants // Homeodomain-like // Myb domain | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTTAAACTCATTCCAAGCGTCCCAAACCTTCGTTCAACTAGCCCACAG |
| Internal bar code: | GCTACAATTCTTTCGGCAACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5164 |
| LEAP-Seq percent confirming: | 89.5522 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGATGGTTGTTGTTGCTG |
| Suggested primer 2: | CTGGAGGTGTCGGCAGAAAT |