| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.070238 |
| Chromosome: | chromosome 13 |
| Location: | 760861 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g566700 | (1 of 1) K11094 - U2 small nuclear ribonucleoprotein B'' (SNRPB2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGGTGGCCCTGCCCCCCTTCCCTTCCCTTCCCTTCCTCTTCCTCTTC |
| Internal bar code: | ATGCTATGTCCGGGTCCCTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 445 |
| LEAP-Seq percent confirming: | 35.2941 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCCATTTGAGCCTTCACT |
| Suggested primer 2: | CGCCTGTTCCCTCTGTCTTT |