| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.070269 |
| Chromosome: | chromosome 6 |
| Location: | 5695612 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g288050 | MGTE1,MGTE | Mg2+/divalent cation transporter; (1 of 2) PF01769 - Divalent cation transporter (MgtE) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCTCCCGTGCCATCGCGAGCAGCCTTGCACTGTGCGCACACACACGC |
| Internal bar code: | GTAGGGGGAAAACTGCCTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 113 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATCTCCATGTGGGCCAAC |
| Suggested primer 2: | GACCTTGCTGCAATGCAACA |