Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.070278 |
Chromosome: | chromosome 9 |
Location: | 2909280 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390450 | POB15 | Proteome of basal body 15; (1 of 88) IPR011333 - POZ domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCATATTCATACATTCATACATGCTCCAGCCGTCCAGCGGCCCCACGG |
Internal bar code: | GCGGAATTATTGTTAGTAACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1276 |
LEAP-Seq percent confirming: | 72.2222 |
LEAP-Seq n confirming: | 65 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 90 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGCGGTACTGATGTCGTG |
Suggested primer 2: | AGGGAGCAAACACACACACA |