Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.070288 |
Chromosome: | chromosome 9 |
Location: | 5101955 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g406350 | (1 of 1) K15287 - solute carrier family 35, member F1/2 (SLC35F1_2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGCGGCGCGCCTGGGCCGCCGCCGACTGGACAGACCCGTGGGCCACCG |
Internal bar code: | GTTGTCGACAAGGAAATCCTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 249 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCCATACCACCTCGCTC |
Suggested primer 2: | CACTCACAACATGCACGCAA |