| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070294 |
| Chromosome: | chromosome 12 |
| Location: | 5476578 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g801432 | (1 of 2) PF00628//PF00665//PF09337 - PHD-finger (PHD) // Integrase core domain (rve) // His(2)-Cys(2) zinc finger (zf-H2C2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGAGGTTCACGAGGGAGAGGGCTAGGGGGGCGAGCGCTGGGGGGGCAG |
| Internal bar code: | TAAACGGACAGCTAAACAGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3344 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCACCCTACCTACTCCT |
| Suggested primer 2: | CCAGGAGGCTAAGATGGTGC |