| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.070297 |
| Chromosome: | chromosome 12 |
| Location: | 1166534 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g490750 | (1 of 239) IPR016024 - Armadillo-type fold | 3'UTR | |
| Cre12.g490800 | (1 of 6) IPR000104//IPR000719//IPR002290//IPR011009//IPR020635 - Antifreeze protein, type I // Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACGACAACGACAGTTTCATGTCTCTTGAGGCCAGCTAACATGCCGCTA |
| Internal bar code: | CTTCGGATCGGTGGCGGAGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4455 |
| LEAP-Seq percent confirming: | 98.75 |
| LEAP-Seq n confirming: | 79 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 80 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACTCAGCGCATGATGGTT |
| Suggested primer 2: | CAAACGTCGCCGCGAATAAT |