Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.070299 |
Chromosome: | chromosome 9 |
Location: | 2608222 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g392250 | OTU5 | (1 of 2) IPR000104//IPR003323 - Antifreeze protein, type I // OTU domain; OTU-like cysteine protease | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGAGCTTAGAGAGCAAGGCGGGACTAAGACCAATTCTACTGTCGATAA |
Internal bar code: | TTCGGGAAGGCGGCAAGCGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2360 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGGGTGCACTGAAGACTG |
Suggested primer 2: | TCGAGGTGTGTCAGAAGCAC |