| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.070333 |
| Chromosome: | chromosome 1 |
| Location: | 7610069 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g800140 | (1 of 1) K12800 - NACHT, LRR and PYD domains-containing protein 3 (NLRP3, PYPAF1) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGTAAGATGCTTAACAATGTTGGTGCATTGTTGGTGGGATGTTTCTA |
| Internal bar code: | CTTCTGAGCTATTATAGATGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1912 |
| LEAP-Seq percent confirming: | 58.8889 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 90 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTAGCCCACGCACCTTAA |
| Suggested primer 2: | ATGGGGTTTTGAGGAGCGAG |