| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.070338 |
| Chromosome: | plastome |
| Location: | 124223 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802314 | 2717041,ChreCp050,atpA | (1 of 1) K02111 - F-type H+-transporting ATPase subunit alpha (ATPF1A, atpA); ATP synthase CF1 alpha chain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAATAATACCGCACCTACGTTGTTTGCTTCTAAGTTAAGTGCAATACCT |
| Internal bar code: | GATCGATCAGGATGCCCTGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 680 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTGTCAGGGGATAAGCGA |
| Suggested primer 2: | GAGCTGCAGAACCTACACGT |