| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070352 |
| Chromosome: | chromosome 12 |
| Location: | 9652179 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g558353 | (1 of 11) PF00999 - Sodium/hydrogen exchanger family (Na_H_Exchanger) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCTTGGGCAATGCCCCCTGGCCCTCCCCCACCTCCCAACCTCAAACAT |
| Internal bar code: | CCGCATCAGGCCAAAGATCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 72 |
| LEAP-Seq percent confirming: | 13.3333 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTTCCAGCTGTCACGGAG |
| Suggested primer 2: | CACCTCCATACCCATACGGC |