Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.070363 |
Chromosome: | chromosome 11 |
Location: | 1406023 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g801257 | (1 of 11) PF07173 - Protein of unknown function (DUF1399) (DUF1399) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCTCCTTAGGCCTGTACCTGGCCTCAACCTGAAGTGGTTCTGTGCGC |
Internal bar code: | TACGCGAGCAGCGACGGCATCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3736 |
LEAP-Seq percent confirming: | 97.9021 |
LEAP-Seq n confirming: | 140 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 143 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAGCTAGCAACCCCGCTAC |
Suggested primer 2: | ACGTACGTGGCCTTGTGATT |