| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.070380 |
| Chromosome: | chromosome 10 |
| Location: | 4180659 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g449100 | MCP25 | (1 of 2) K15110 - solute carrier family 25 (mitochondrial 2-oxodicarboxylate transporter), member 21 (SLC25A21, ODC); Mitochondrial substrate carrier protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTTGTCAAGTAGAATTAAAGGCATTCCGCTGCTGGTAGCGGTGCCGC |
| Internal bar code: | ATTAGGCACCTTCGCAAAAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3851 |
| LEAP-Seq percent confirming: | 98.8764 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 89 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGATGGTGGTCCTGTAAC |
| Suggested primer 2: | GAAACCCTCCATGCACCTGA |