| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070397 |
| Chromosome: | chromosome 6 |
| Location: | 1795596 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g263289 | (1 of 1) 2.5.1.87 - Ditrans,polycis-polyprenyl diphosphate synthase ((2E,6E)-farnesyl diphosphate specific) / Rer2p Z-prenyltransferase | 5'UTR | |
| Cre06.g263300 | (1 of 2) PF05648 - Peroxisomal biogenesis factor 11 (PEX11) (PEX11) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACAAACGTGCGCTACAAGAAACAGCGCAAACCCAGTGCGTCCTCGCAGC |
| Internal bar code: | CTGGGAAGCACGAAAAAATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1063 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTAACACTCAGGTGGCGT |
| Suggested primer 2: | CTTGTGGACCTTGCTGTTGC |