| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.070404 |
| Chromosome: | chromosome 8 |
| Location: | 4370049 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g384864 | (1 of 1) PF00018//PF14604 - SH3 domain (SH3_1) // Variant SH3 domain (SH3_9) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACATGGCTCCGGCCCCAGCGAAGGGGTCCGGGCCAGGTCCCGCTGAGC |
| Internal bar code: | GAGGGCTGAAGACGCGAGTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 823 |
| LEAP-Seq percent confirming: | 73.3333 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGGCATGGATGAGGTTGG |
| Suggested primer 2: | TTGATGAGCCGCTCGATCTC |