Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.070404 |
Chromosome: | chromosome 8 |
Location: | 4370052 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g384864 | (1 of 1) PF00018//PF14604 - SH3 domain (SH3_1) // Variant SH3 domain (SH3_9) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCTATAGTTACTGTGGCTTGAGTCTCATATAGTTGACAAGTCCGATGG |
Internal bar code: | ACTATAGTACCGCCGACGCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1320 |
LEAP-Seq percent confirming: | 97.2973 |
LEAP-Seq n confirming: | 36 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGATGAGCCGCTCGATCTC |
Suggested primer 2: | ATGGGCATGGATGAGGTTGG |