| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070412 |
| Chromosome: | chromosome 1 |
| Location: | 5527556 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039350 | NCR2 | Cytochrome P450 reductase, possibly CYP505 family; (1 of 2) 1.6.2.4 - NADPH--hemoprotein reductase / TPNH-cytochrome c reductase | 5'UTR |
| Cre01.g039400 | (1 of 1) 3.8.1.5 - Haloalkane dehalogenase / 1-chlorohexane halidohydrolase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAATATGTTTGAACGGCGCTTCCGCTTCAGCGCGACTGAAGGTACCCGA |
| Internal bar code: | GGCTTGCATTGATAGCACTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3463 |
| LEAP-Seq percent confirming: | 98.75 |
| LEAP-Seq n confirming: | 79 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 80 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCTGTCGACCTTGTCACA |
| Suggested primer 2: | GTTTCTGTGCACGTCACCAC |