| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.070434 |
| Chromosome: | chromosome 16 |
| Location: | 4902043 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686850 | PTA4 | (1 of 10) IPR005828//IPR020846 - Major facilitator, sugar transporter-like // Major facilitator superfamily domain; Proton/phosphate symporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCATGACCTGCATGCGCATGCGGCCCATCCACGGCTTGTCCACCGTGA |
| Internal bar code: | GCGTGTATCTTGTCTTGCCAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2287 |
| LEAP-Seq percent confirming: | 1.78571 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 55 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCTCAACGGTCTCCCTAT |
| Suggested primer 2: | CATCGGGGATGGTGATCAGG |