| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.070446 |
| Chromosome: | chromosome 14 |
| Location: | 3629457 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g801660 | (1 of 1) PF00059//PF01476 - Lectin C-type domain (Lectin_C) // LysM domain (LysM) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGAGCGGAACCCCTGCCCACGTGCTACCCAAGCTTGTCAGCTCTCGCG |
| Internal bar code: | AGATAATTTTAGGGGCCACGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 877 |
| LEAP-Seq percent confirming: | 70.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTAGCTGCGTTGGGATGC |
| Suggested primer 2: | TGGTTACACGCAACCCTACC |