| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070450 |
| Chromosome: | contig 26 |
| Location: | 13453 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734757 | TET5 | (1 of 12) PF12851 - Oxygenase domain of the 2OGFeDO superfamily (Tet_JBP); {"non-canonical TET-dioxygenase, putative 5-methylcytosine-modifying enzyme | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGATGCAGAAGTTCTTGTTGCGCAGCGCTTGCCTGTATATACACAAT |
| Internal bar code: | CCGGCATTCAGGTAGCTTGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 173 |
| LEAP-Seq percent confirming: | 3.125 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAAGCTTCGCAAGGTGTA |
| Suggested primer 2: | CAAACATGTGCACAGCGTCA |