| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070488 |
| Chromosome: | chromosome 2 |
| Location: | 4026706 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g102950 | (1 of 1) K18999 - RNA polymerase II C-terminal domain phosphatase-like 3/4 [EC:3.1.3.16] (CPL3_4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACCTCGCCCGTACATTCCACACCCGCCATGCGGTATGTGTCACATACT |
| Internal bar code: | CTGTGAATTAGGTAGAGTCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 116 |
| LEAP-Seq percent confirming: | 64.2857 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGTGCTGCAAAGATATGG |
| Suggested primer 2: | TTGGTCCATAGGCAGCAGTG |