| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.070581 |
| Chromosome: | chromosome 12 |
| Location: | 5086260 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g525750 | (1 of 8) IPR000719//IPR002290//IPR011009//IPR020635//IPR020636 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // Calcium/calmodulin-dependent/calcium-dependent protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCAAACGCAATGCCCTAGCGACGCACCACGGCCTGCCAGCTGTGCCAT |
| Internal bar code: | TGGTACTGTAGTAGAATCGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2650 |
| LEAP-Seq percent confirming: | 23.4043 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGGCGCTCTTCATCAAGC |
| Suggested primer 2: | GCTGTGTCCAACAAGTGCTG |