Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.070586 |
Chromosome: | plastome |
Location: | 128283 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802317 | atpH,ChreCp053,2717044 | ATPase III subunit; (1 of 1) K02110 - F-type H+-transporting ATPase subunit c (ATPF0C, atpE) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTCGTCAACCTGAAGCTGAAGGTAAAATCCGTGGTGCGCTTTTATTA |
Internal bar code: | TATAAAATGAACCAACCGCTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 159 |
LEAP-Seq percent confirming: | 25.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGAAGCACCAAAGGCAGT |
Suggested primer 2: | CCTTCCGCAGAGGGTGAAAT |