| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.070664 |
| Chromosome: | chromosome 13 |
| Location: | 1974447 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g576550 | (1 of 93) 6.3.2.19 - Transferred entry: 2.3.2.23, 2.3.2.27 and 6.2.1.45 | 3'UTR | |
| Cre13.g801525 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTGTAACAATCACTTTTAAAACACGAAGCAACCAACGGGTTAACGGGT |
| Internal bar code: | GTACTCCGGTAACGTTCCAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1871 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAGAGCTGGCCTTGATTT |
| Suggested primer 2: | CTTTCCGTGAGCGCATGATG |