| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070698 |
| Chromosome: | chromosome 8 |
| Location: | 4454781 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g385700 | SNAPG1 | (1 of 1) PTHR13768:SF2 - GAMMA-SOLUBLE NSF ATTACHMENT PROTEIN; Gamma-SNAP, SNARE complex protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGGCAGCAGCCCAGTTGCGAGCTGGAACACGTCCGCCCCTGCAAGCGG |
| Internal bar code: | ATAGGACGCTGCCAAGGGTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2343 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 75 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAAGGCAGTCTACACAGG |
| Suggested primer 2: | CACCCGCTACTGACTGGTTT |