| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.070701 |
| Chromosome: | chromosome 6 |
| Location: | 8515897 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g800754 | (1 of 5) K11446 - histone demethylase JARID1 [EC:1.14.11.-] (JARID1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACTTCTCACTCGCACCTTTCTCTCAGGCTGATAGCAAGCAAGGTTAAT |
| Internal bar code: | CCCGGGTGGAGGTACTGACGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5698 |
| LEAP-Seq percent confirming: | 55.8511 |
| LEAP-Seq n confirming: | 105 |
| LEAP-Seq n nonconfirming: | 83 |
| LEAP-Seq n unique pos: | 188 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGGTATTCGGGATGGAGG |
| Suggested primer 2: | GCCCCCTGCAGTGACTAAAT |