| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.070704 |
| Chromosome: | chromosome 2 |
| Location: | 1584522 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g084900 | RPAP3 | RNA polymerase II-associated protein 3; (1 of 1) PF13414//PF13877 - TPR repeat (TPR_11) // Potential Monad-binding region of RPAP3 (RPAP3_C) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCGGCGCCGGCGGCCGCCTCGCGGCCCGACGGCATTGCGTTCAAGGA |
| Internal bar code: | GTTTCGGGCATTCGATGATCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 318 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCTTCCACCGCTTCATCT |
| Suggested primer 2: | CTGGCAGCAGTCCATGAAGA |