| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.070719 |
| Chromosome: | chromosome 1 |
| Location: | 5607981 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040000 | RPL26 | (1 of 1) K02898 - large subunit ribosomal protein L26e (RP-L26e, RPL26); Cytosolic 80S ribosomal protein L26 | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCGCCGAGCACCGCTGAGTCCAGCCCGCTGGTGCACTCTAACTGCAG |
| Internal bar code: | TTGAAAGCAGGGACGTACGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1435 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAACGCGCCTCAGTAACAA |
| Suggested primer 2: | AGGTACAGGCGAGTCCTCAT |