| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070745 |
| Chromosome: | chromosome 12 |
| Location: | 4217880 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518000 | SCA2,SECA2 | (1 of 1) PF01043//PF07517 - SecA preprotein cross-linking domain (SecA_PP_bind) // SecA DEAD-like domain (SecA_DEAD); Chloroplast-associated SecA protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACGCAAGCAGCAAAACGGTGGCCAGGCAGTGAACGCAACCACGTAAAC |
| Internal bar code: | ATTAGTTGTTAGAATTCTAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2311 |
| LEAP-Seq percent confirming: | 5.88235 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACAACGCGCTTTCAACAC |
| Suggested primer 2: | TACGTGCCAACCGACATTCA |