Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.070747 |
Chromosome: | chromosome 17 |
Location: | 4513201 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g802092 | (1 of 1) PF00050//PF05548//PF07648 - Kazal-type serine protease inhibitor domain (Kazal_1) // Gametolysin peptidase M11 (Peptidase_M11) // Kazal-type serine protease inhibitor domain (Kazal_2) | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCCAGTGTGACCGGTGACAGTGTGACAGTCCTTCACGAAAACCATCG |
Internal bar code: | CGGAATGCACTTACGTGAATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 849 |
LEAP-Seq percent confirming: | 58.3333 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTAAAGCGTACGGTTGGCT |
Suggested primer 2: | GTGCACAATACAGTAGCGCG |