Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.070763 |
Chromosome: | chromosome 1 |
Location: | 4820850 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g033550 | PDI2 | (1 of 1) PTHR18929:SF87 - PROTEIN C03H12.1, ISOFORM A; Protein disulfide isomerase 2 | outside_mRNA |
Cre01.g800091 | (1 of 1) K18663 - activating signal cointegrator complex subunit 3 [EC:3.6.4.12] (ASCC3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCGTGGACCCCCAGGAACGAGGACCGACCCCCCAACTTTGGCGGCCTA |
Internal bar code: | GTTAGAGCCTTCAAAGCTGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 758 |
LEAP-Seq percent confirming: | 65.7143 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGTTTTGAGCTAGCGACA |
Suggested primer 2: | AAACAAAGTGCCAGACCCCA |