Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.070807 |
Chromosome: | chromosome 1 |
Location: | 5361306 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g037850 | BCC2,BXP2, BCCP2 | Acetyl-CoA biotin carboxyl carrier; (1 of 1) IPR000089//IPR011053 - Biotin/lipoyl attachment // Single hybrid motif | 3'UTR |
lncRNA_TCONS_00014348 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGAGCCGCTGGTGGCAGCGGGACCGCCCTGGGTACGTGTGTGCATATG |
Internal bar code: | GGCATGCGCGGGATGTTGATAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1794 |
LEAP-Seq percent confirming: | 60.7143 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACAAGCGACCAGGAAGTC |
Suggested primer 2: | GCTATTGCCTCGAATGCAGC |