| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.070811 |
| Chromosome: | chromosome 13 |
| Location: | 702201 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g566450 | ROC104 | (1 of 66) 2.7.12.1 - Dual-specificity kinase; Rhythm of Chloroplast bioluminescence 104 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATAACTTAAGCTCAGCGCAACGAGCGCTTGCGTATACAATTTCTTCGT |
| Internal bar code: | TATTCGAGCTGCCTGATCTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1502 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCTTGCCAGAGTCCTGTT |
| Suggested primer 2: | TAGCACAGCACAGTAGCACC |