| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070816 |
| Chromosome: | chromosome 9 |
| Location: | 6674190 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g416700 | Related to rhamnosyl methyltransferase; (1 of 10) PF13578 - Methyltransferase domain (Methyltransf_24) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCGTGTACCACTGTGCGGCCAGCAATATGCGGCATAGGCACACGTCC |
| Internal bar code: | CGCAGGCGCATGTAAAGGCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 454 |
| LEAP-Seq percent confirming: | 84.6154 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAGTAGAGCTCGATGTCC |
| Suggested primer 2: | TAAGCAATTGCCTCCCCTGG |