| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070816 |
| Chromosome: | plastome |
| Location: | 187691 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802331 | 2716963,ChreCp066,psbC | (1 of 1) K02705 - photosystem II CP43 chlorophyll apoprotein (psbC); photosystem II 43 kDa protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGTGTAATGGGCTTCATTGCTTGTTGTATGTCTTGGTTCAACAATAC |
| Internal bar code: | AATCCGGCGGCACATGTACTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 264 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTCGAAACCAGCAGCAGC |
| Suggested primer 2: | GGCCGTGACCAAGAAACAAC |