| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.070898 |
| Chromosome: | contig 43 |
| Location: | 8236 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre43.g802229 | (1 of 3) 4.1.1.31 - Phosphoenolpyruvate carboxylase / Phosphoenolpyruvic carboxylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCCAGCCCGGGGCCCGTCCAGATAATATCCAACCCTGCCAGCGAGTGC |
| Internal bar code: | GGAATACGAATGCTCCGTGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1009 |
| LEAP-Seq percent confirming: | 21.6216 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTATCCCTTCGTACGCACC |
| Suggested primer 2: | GGTGTTTGGGATTGTGTGCC |